Lessons for Mutation

Page 1 of 366 results

  • DNA Mutations - … for this lesson will include point mutation, frameshift mutation, deletion, insertion, translocation, substitution, and inversion. The DNA Mutations Powerpoint presentation can be used … for this lesson will include point mutation, frameshift mutation, deletion, insertion, translocation, substitution, and inversion. The DNA Mutations Powerpoint presentation can be used … for this lesson will include point mutation, frameshift mutation, deletion, insertion, translocation, substitution, and inversion. The DNA Mutations Powerpoint presentation can be used …
    User Rating:
  • Genetic Disorders Research - … different types of mutations in the genetic code. 2.)Distribute the mutations notes handout, and begin instruction on genetic mutations. Upon completion of … different types of mutations in the genetic code. 2.)Distribute the mutations notes handout, and begin instruction on genetic mutations. Upon completion of … different types of mutations in the genetic code. 2.)Distribute the mutations notes handout, and begin instruction on genetic mutations. Upon completion of …
    User Rating:
  • How Things Go Wrong - … mutation occur and what effect those mutations will have. Objectives Students will be able to:- 1. Differentiate mutations that affect an individual and mutations … ways. Missense Mutation: A point mutation that results in a single amino acid change in a protein. Nonsense Mutation: A point mutation that can … . Insertion Mutation: The addition of a DNA base. Deletion Mutation: The removal of a DNA base. Frameshift Mutation: Caused by insertion or deletion mutations
    User Rating: Grade Level: 9-12
  • Cancer as a Multistep Process - … tool that students can use to observe how mutation frequency and the number of mutations (hits) required for the development of cancer … colon cancer incidence suggested to epidemiologists that more than one mutational event was involved in cancer's development. Similar graphs of … is some evidence, for example, that some mutations increase the probability that other mutations will occur. In addition, the models do not …
    User Rating: Grade Level: 9-12
  • DNA Mutations - … area:Yes Freely Available: Yes Keywords: Amino Acid sequence, DNA mutations, mutations, Instructional Component Type(s): Lesson Plan, Worksheet, Formative Assessment Resource … DNA sequences and mutations. For example: Student Set 1: Original: TACCTTGTACCGTAGGCATTAATGGTAATT Mutation 1: TACCTTGTTCCGTAGGCATTAATGGTAATT Student Set 2: Original: TACCTTGTACCGTAGGCATTAATGGTAATT Mutation 2: TACCTTGTACCGTAGGCAATTAATGGTAATT The …
    User Rating: Grade Level: 9-12
  • What a Whale of a Change - … can result in dramatic, observable changes, in this unit, point mutations (mutations affecting a single gene) and the implications of the affect … synthesis Define and be able to identify: point mutation, Missense mutation, nonsense mutation, silent mutation, frame-shift mutations (insertion and deletion) Translate amino acid sequences Infer the general affect particular point mutations might have on …
    User Rating: Grade Level: 6-12
  • The Making of a Super Hero (39855) - … questions on a separate sheet of paper What is a mutation? Are mutations good or bad? (Provide an example) 2. Share student … in the following day.1. Populations evolve through mutations. What exactly are mutations? Can mutations have helpful effects, harmful effects or no effects … phenotypic change in the other two types of point mutations. 4. Are mutations in DNA advantageous or disadvantageous? EXPLAIN! Summative Assessment The …
    User Rating: Grade Level: 9-12
  • The Role of Mutation in Evolution - … individual's genes may have undergone mutation into a different allele. * Most mutations are not beneficial. * Some mutations are advantageous but too many … works by the gradual accumulation of small but advantageous mutations. * Even advantageous mutations are often lost in subsequent generations. The Lesson Plan … . Pupils will be able to experiment with the 'mutation rate', noting that high mutation rates will lead to unsuccessful Sodacreatures (probably), which …
    User Rating: Grade Level: 9-12
  • Obesity - … , ultimately influencing appetite, body fat storage, and other physiologic processes. mutation: A change in a gene that alters the message carried … Write a possible outcome or consequence of the following mutations or conditions. * A mutation alters the amount of hormone produced: (When little … Write a possible outcome or consequence of the following mutations or conditions. * A mutation alters the amount of hormone produced: 4 Design …
    User Rating: Grade Level: 3-8
  • Gene Inheritance - … mother and one from your father. If a mutation occurs in a gene, that mutation can be passed on to offspring. 2 … the A Mutation Story video: HH: normal, no mutation Hh: one normal gene, one mutated gene, protection from malaria hh: two mutated genes, sickle … Inherited How Genetic Disorders Are Inherited PDF Document A Mutation Story A Mutation Story QuickTime Video One Wrong Letter One Wrong Letter …
    User Rating: Grade Level: 6-8
Copyright © 2016 Lesson Corner. All rights reserved.